Top » Catalog » SNPs » BY152878

$18.00

BY152878
[BY152878]

BY152878
hg38 Position: ChrY:8452271..8452271
Ancestral: T
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > Z2265 > BY30097 > BY11501 > BY11506 > BY50723 > BY152352
Forward Primer: BY152878_F GAAGCAACTACCTGATATGTGATATGAG
Reverse Primer: BY152878_R CAAATTTGGAAGAAAAATAGACAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies