Top » Catalog » SNPs » BY154503

$18.00

BY154503
[BY154503]

BY154503
hg38 Position: ChrY:15794619..15794619
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > Z2265 > BY30097 > BY11501 > BY11506 > BY50723 > BY152352
Forward Primer: BY154503_F ATTGCTGGCTTTGAAGATGG
Reverse Primer: BY154503_R AAGGGCTGAGGTACACAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies