Top » Catalog » SNPs » BY195651

$18.00

BY195651
[BY195651]

BY195651
hg38 Position: ChrY:17194172..17194172
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below U106 > Z2265 > BY30097 > BY11501 > BY11506 > BY50723 > BY152352
Forward Primer: BY195651_F TCACTGCCCCTTCTCCTC
Reverse Primer: BY195651_R ATTTTAATTGCCTGAAGCTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies