Top » Catalog » SNPs » ZS2053

$18.00

ZS2053
[ZS2053]

ZS2053
hg38 Position: ChrY:9804104..9804104
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 205557; downstream BY6
Forward Primer: ZS2053_F GGAAAACTCCCGATTTGACC
Reverse Primer: ZS2053_R CTTTCCCGAAGTCCCTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies