Top » Catalog » SNPs » A18381

$15.00

A18381
[A18381]

A18381
hg38 Position: ChrY:15692468..15692468
Ancestral: G
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: R1b-L21 (x DF13 DF63 A5846 A7906 BY3031)
Forward Primer: A18381_F CTAAGTCAGCTCTCTAAATGTCTCATG
Reverse Primer: A18381_R GCAGCAGCATTCTCCTTTACAG
Reviews

Customers who bought this product also purchased
A18371
A18371
A18367
A18367
A18359
A18359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies