Top » Catalog » SNPs » BY27831

$18.00

BY27831
[BY27831]

BY27831
hg38 Position: ChrY:7875845..7875845
Ancestral: T
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF27 > ZZ12
Forward Primer: BY27831_F TGTTTGTGGGCATTGTTCAG
Reverse Primer: BY27831_R TCACTCTTCAGACAGGTGCG
Reviews

Customers who bought this product also purchased
BY41289
BY41289
Y38083
Y38083
L48
L48
FGC46562
FGC46562
FT43199
FT43199
V7594
V7594
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies