Top » Catalog » SNPs » BY27831

$18.00

BY27831
[BY27831]

BY27831
hg38 Position: ChrY:7875845..7875845
Ancestral: T
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF27 > ZZ12
Forward Primer: BY27831_F TGTTTGTGGGCATTGTTCAG
Reverse Primer: BY27831_R TCACTCTTCAGACAGGTGCG
Reviews

Customers who bought this product also purchased
A11625
A11625
BY129286
BY129286
A11632
A11632
BY16029
BY16029
FT65663
FT65663
FGC20761
FGC20761
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies