Top » Catalog » SNPs » BY27831

$18.00

BY27831
[BY27831]

BY27831
hg38 Position: ChrY:7875845..7875845
Ancestral: T
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF27 > ZZ12
Forward Primer: BY27831_F TGTTTGTGGGCATTGTTCAG
Reverse Primer: BY27831_R TCACTCTTCAGACAGGTGCG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
BY166244
BY166244
BY39545
BY39545
BY123788
BY123788
M12109
M12109
BY21078
BY21078
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies