Top » Catalog » SNPs » BY3332

$18.00

BY3332
[BY3332]

BY3332
hg38 Position: ChrY:19862493..19862493
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b
Comments: Below DF27
Forward Primer: BY3332_F AGCCTGTCTTCATACTCACTAATATCC
Reverse Primer: BY3332_R ATCTTCAATGCACAGACACTGAG
Reviews

Customers who bought this product also purchased
M12109
M12109
DNA Sample Kit
DNA Sample Kit
BY166244
BY166244
BY39545
BY39545
BY123788
BY123788
BY187703
BY187703
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies