Top » Catalog » SNPs » A23880

$18.00

A23880
[A23880]

A23880
hg38 Position: ChrY:20970817..20970817
Ancestral: C
Derived: T
Reference: Zivota Selakovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A23880_F AGAAGTTCAAATTAAATGCTAATAACCAAAC
Reverse Primer: A23880_R CTGGTGACATGAGGATTACAACAC
Reviews

Customers who bought this product also purchased
A23885
A23885
A23878
A23878
A23884
A23884
A23883
A23883
A23882
A23882
Y47407
Y47407
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies