Top » Catalog » SNPs » BY182386

$18.00

BY182386
[BY182386]

BY182386
hg38 Position: ChrY:22349550..22349550
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: BY182386_F ACTCTGGTCTGACACATAACATAAAGTAAG
Reverse Primer: BY182386_R GTAATTCATATCTCAGTACAGTCTCCCAC
Reviews

Customers who bought this product also purchased
Y47407
Y47407
A23880
A23880
A23885
A23885
A23879
A23879
A23884
A23884
A23878
A23878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies