Top » Catalog » SNPs » FGC87743

$18.00

FGC87743
[FGC87743]

FGC87743
hg38 Position: ChrY:13886707..13886707
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC87743_F CACTAGCTACAGGGCCACTAAGG
Reverse Primer: FGC87743_R GCGGGCACAATCTTTTGAG
Reviews

Customers who bought this product also purchased
DYS464
DYS464
YSEQ-Alpha
YSEQ-Alpha
M35
M35
L608
L608
M267
M267
ZS5010
ZS5010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies