Top » Catalog » SNPs » FGC10080

$18.00

FGC10080
[FGC10080]

FGC10080
hg38 Position: ChrY:20877818..20877818
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2c1h (not listed)
Comments: Found in a R1b-L371 person
Forward Primer: FGC10080_F ACAAATGTTTTCTATTCGGACCTTAG
Reverse Primer: FGC10080_R CCTGCACATGTATTCTACATAATGC
Reviews

Customers who bought this product also purchased
FGC10048
FGC10048
FGC10060
FGC10060
FGC10073
FGC10073
FGC10047
FGC10047
A148
A148
FGC10071
FGC10071
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies