Top » Catalog » SNPs » FGC11134

$18.00

FGC11134
[FGC11134]

FGC11134
hg38 Position: ChrY:19221580..19221580
Ancestral: T
Derived: A
Reference: Full Genomes Inc (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c
Comments: Downstream DF13 and upstream of CTS4466
Forward Primer: FGC11134_F TTATTAATAGCAAAGAATAATTGAAATCTCAC
Reverse Primer: FGC11134_R ATGCCAGGTGGCAACTTG
Reviews

Customers who bought this product also purchased
A11683
A11683
A761
A761
A10641
A10641
A12590
A12590
A7763
A7763
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies