Top » Catalog » SNPs » FGC11134

$18.00

FGC11134
[FGC11134]

FGC11134
hg38 Position: ChrY:19221580..19221580
Ancestral: T
Derived: A
Reference: Full Genomes Inc (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c
Comments: Downstream DF13 and upstream of CTS4466
Forward Primer: FGC11134_F TTATTAATAGCAAAGAATAATTGAAATCTCAC
Reverse Primer: FGC11134_R ATGCCAGGTGGCAACTTG
Reviews

Customers who bought this product also purchased
FGC11272
FGC11272
A12386
A12386
BY23383
BY23383
FGC11304
FGC11304
A11683
A11683
A12590
A12590
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies