Top » Catalog » SNPs » FGC11134

$18.00

FGC11134
[FGC11134]

FGC11134
hg38 Position: ChrY:19221580..19221580
Ancestral: T
Derived: A
Reference: Full Genomes Inc (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c
Comments: Downstream DF13 and upstream of CTS4466
Forward Primer: FGC11134_F TTATTAATAGCAAAGAATAATTGAAATCTCAC
Reverse Primer: FGC11134_R ATGCCAGGTGGCAACTTG
Reviews

Customers who bought this product also purchased
CTS5396
CTS5396
L1065
L1065
FGC32846
FGC32846
S5979
S5979
BY246
BY246
A2070
A2070
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies