Top » Catalog » SNPs » L48

$18.00

L48
[L48]

L48
hg38 Position: ChrY:21450311..21450311
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b
Comments: .
Forward Primer: L48_F CAGGCAACACTCGTGTGCT
Reverse Primer: L48_R GTAATGGGTGATGAGGCTGC
Reviews

Customers who bought this product also purchased
A9580
A9580
Y18100
Y18100
F2437
F2437
Z16501
Z16501
YFS449079
YFS449079
ZS10715
ZS10715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies