Top » Catalog » SNPs » L48

$18.00

L48
[L48]

L48
hg38 Position: ChrY:21450311..21450311
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b
Comments: .
Forward Primer: L48_F CAGGCAACACTCGTGTGCT
Reverse Primer: L48_R GTAATGGGTGATGAGGCTGC
Reviews

Customers who bought this product also purchased
HVR1
HVR1
YSEQ-Alpha
YSEQ-Alpha
FGC60978
FGC60978
BY205963
BY205963
Y22517
Y22517
S21607
S21607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies