Top » Catalog » SNPs » L48

$18.00

L48
[L48]

L48
hg38 Position: ChrY:21450311..21450311
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b
Comments: .
Forward Primer: L48_F CAGGCAACACTCGTGTGCT
Reverse Primer: L48_R GTAATGGGTGATGAGGCTGC
Reviews

Customers who bought this product also purchased
ZP87
ZP87
CTS11019
CTS11019
YSEQ-Alpha
YSEQ-Alpha
P89.2
P89.2
FGC13316
FGC13316
S16265
S16265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies