Top » Catalog » SNPs » L48

$18.00

L48
[L48]

L48
hg38 Position: ChrY:21450311..21450311
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b
Comments: .
Forward Primer: L48_F CAGGCAACACTCGTGTGCT
Reverse Primer: L48_R GTAATGGGTGATGAGGCTGC
Reviews

Customers who bought this product also purchased
BY160931
BY160931
FGC23143
FGC23143
FT116833
FT116833
Y132015
Y132015
A2273
A2273
PH1822
PH1822
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies