Top » Catalog » SNPs » L48

$18.00

L48
[L48]

L48
hg38 Position: ChrY:21450311..21450311
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b
Comments: .
Forward Primer: L48_F CAGGCAACACTCGTGTGCT
Reverse Primer: L48_R GTAATGGGTGATGAGGCTGC
Reviews

Customers who bought this product also purchased
FGC6204
FGC6204
FGC6198
FGC6198
FGC6225
FGC6225
FGC8604
FGC8604
Y23482
Y23482
Y17243
Y17243
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies