Top » Catalog » SNPs » FGC3249

$18.00

FGC3249
[FGC3249]

FGC3249
hg38 Position: ChrY:15683592..15683592
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > FGC3222
Forward Primer: FGC3249_F CATCAAGAAAATGGAGGAAAGC
Reverse Primer: FGC3249_R AAAAGAGATAACACCACCAATTCC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
Z29749
Z29749
Z2188
Z2188
DF21
DF21
DF49
DF49
A16
A16
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies