Top » Catalog » SNPs » FGC3249

$18.00

FGC3249
[FGC3249]

FGC3249
hg38 Position: ChrY:15683592..15683592
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: Downstream Z253 > FGC3222
Forward Primer: FGC3249_F CATCAAGAAAATGGAGGAAAGC
Reverse Primer: FGC3249_R AAAAGAGATAACACCACCAATTCC
Reviews

Customers who bought this product also purchased
Z29749
Z29749
Z2188
Z2188
Z39589
Z39589
DF13
DF13
L1335
L1335
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies