Top » Catalog » SNPs » A2187

$18.00

A2187
[A2187]

A2187
hg38 Position: ChrY:13673267..13673267
Ancestral: G
Derived: C
Reference: Mark Jost (2015)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC19329
Forward Primer: A2187_F GCCACCTTTCCCTGACTTTC
Reverse Primer: A2187_R CTGCCTAGAGTCCTGGGATG
Reviews

Customers who bought this product also purchased
A2188
A2188
A2186
A2186
A2185
A2185
A2191
A2191
A2190
A2190
A2184
A2184
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies