Top » Catalog » SNPs » A2188

$18.00

A2188
[A2188]

A2188
hg38 Position: ChrY:15599991..15599991
Ancestral: A
Derived: C
Reference: Mark Jost (2015)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC19329
Forward Primer: A2188_F TTTCCAATAAAGAAGCTCAGTTCTTAG
Reverse Primer: A2188_R CATTTCTCAGCCTCTCTCTTGAG
Reviews

Customers who bought this product also purchased
A2184
A2184
A2189
A2189
A2187
A2187
A2186
A2186
A2185
A2185
A2191
A2191
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies