Top » Catalog » SNPs » BY39172

$18.00

BY39172
[BY39172]

BY39172
hg38 Position: ChrY:17083111..17083111
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603
Forward Primer: BY39172_F TTCTGTTACTTTCCTGAGACAGACC
Reverse Primer: BY39172_R GGAAAGGAAAGTGTGTGCTTTG
Reviews

Customers who bought this product also purchased
FGC17603
FGC17603
BY39168
BY39168
A19400
A19400
R1b-FGC17603 MacRae Panel
R1b-FGC17603 MacRae Panel
BY41059
BY41059
BY39171
BY39171
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies