Top » Catalog » SNPs » BY39172

$18.00

BY39172
[BY39172]

BY39172
hg38 Position: ChrY:17083111..17083111
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L1335 > S764 > FGC17603
Forward Primer: BY39172_F TTCTGTTACTTTCCTGAGACAGACC
Reverse Primer: BY39172_R GGAAAGGAAAGTGTGTGCTTTG
Reviews

Customers who bought this product also purchased
BY39171
BY39171
BY39170
BY39170
BY39169
BY39169
FGC17603
FGC17603
BY39168
BY39168
A19400
A19400
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies