Top » Catalog » SNPs » FGC4371

$18.00

FGC4371
[FGC4371]

FGC4371
hg38 Position: ChrY:8747194..8747194
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC4371_F TGAATGTGTGGTTCCCCATC
Reverse Primer: FGC4371_R CAAACTTTTGGTGGCCTCTC
Reviews

Customers who bought this product also purchased
ZS10474
ZS10474
FT196050
FT196050
FGC40709
FGC40709
Y145691
Y145691
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FGC10579
FGC10579
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies