Top » Catalog » SNPs » FGC4371

$18.00

FGC4371
[FGC4371]

FGC4371
hg38 Position: ChrY:8747194..8747194
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1-FGC1696
Comments: Downstream of J1-FGC1696
Forward Primer: FGC4371_F TGAATGTGTGGTTCCCCATC
Reverse Primer: FGC4371_R CAAACTTTTGGTGGCCTCTC
Reviews

Customers who bought this product also purchased
FGC40709
FGC40709
Y145691
Y145691
ZS10474
ZS10474
FT196050
FT196050
FGC10579
FGC10579
M96
M96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies