Top » Catalog » SNPs » A1540

$18.00

A1540
[A1540]

A1540
hg38 Position: ChrY:16025277..16025277
Ancestral: C
Derived: A
Reference: Robert Hughes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream Z16329
Forward Primer: A1540_F CTGTCACCATCACCCATCAC
Reverse Primer: A1540_R GCAAAGCTCTAGCCCACTACC
Reviews

Customers who bought this product also purchased
Y3640
Y3640
DNA Sample Kit
DNA Sample Kit
Z345
Z345
A1544
A1544
A1543
A1543
A1541
A1541
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies