Top » Catalog » SNPs » BY616

$18.00

BY616
[BY616]

BY616
hg38 Position: ChrY:7560590..7560590
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2c
Comments: Downstream of L513
Forward Primer: BY616_F CACGAAGAAGAAATCGTGTTTATG
Reverse Primer: BY616_R GTGGTCACTTCAGAGGAGGTG
Reviews

Customers who bought this product also purchased
Z16340
Z16340
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies