Top » Catalog » SNPs » FGC3923

$19.00

FGC3923
[FGC3923]

FGC3923
hg38 Position: ChrY:12939309..12939309
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC3923_F TTTGAGATGGAATTGTGCCC
Reverse Primer: FGC3923_R CAGTGGAGATCACGCCATC
Reviews

Customers who bought this product also purchased
R1b-L626 Segregation Panel
R1b-L626 Segregation Panel
FGC3944
FGC3944
FGC3928
FGC3928
FGC3921
FGC3921
FGC3910
FGC3910
FGC3924
FGC3924
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies