Top » Catalog » SNPs » FGC19435

$19.00

FGC19435
[FGC19435]

FGC19435
hg38 Position: ChrY:13071938..13071938
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: 9919 branch
Forward Primer: FGC19435_F TGGTTCATCTCACTGATACTAGTCAG
Reverse Primer: FGC19435_R CAGGCAGTCAGGCCTCAG
Reviews

Customers who bought this product also purchased
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23338
FGC23338
FGC19446
FGC19446
FGC31787
FGC31787
FGC23332
FGC23332
FGC33213
FGC33213
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies