Top » Catalog » SNPs » FGC33208

$18.00

FGC33208
[FGC33208]

FGC33208
hg38 Position: ChrY:8659163..8659163
Ancestral: A
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33208v2_F GAGAAACTGCTGGGCTGC
Reverse Primer: FGC33208v2_R GTGAGGGGATCTGAGGAAAAC
Reviews

Customers who bought this product also purchased
FGC31784
FGC31784
FGC33212
FGC33212
FGC19435
FGC19435
FGC32877
FGC32877
FGC19454
FGC19454
FGC23334
FGC23334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies