Top » Catalog » SNPs » M12430

$18.00

M12430
[M12430]

M12430
hg38 Position: ChrY:6887802..6887802
Ancestral: G
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood
Forward Primer: M12430_F ATGCTCTCCCTCCATTTGC
Reverse Primer: M12430_R TAGTTTGGCCATTGTGCAAG
Reviews

Customers who bought this product also purchased
A19352
A19352
A19341
A19341
A19357
A19357
A19346
A19346
CTS10301
CTS10301
A19351
A19351
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies