Top » Catalog » SNPs » M12430

$18.00

M12430
[M12430]

M12430
hg38 Position: ChrY:6887802..6887802
Ancestral: G
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood
Forward Primer: M12430_F ATGCTCTCCCTCCATTTGC
Reverse Primer: M12430_R TAGTTTGGCCATTGTGCAAG
Reviews

Customers who bought this product also purchased
A19933
A19933
A19344
A19344
M12462
M12462
A19349
A19349
A19354
A19354
A19932
A19932
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies