Top » Catalog » SNPs » S20550

$19.00

S20550
[S20550]

S20550
hg38 Position: ChrY:15939127..15939127
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: downstream of PF6658/Z193
Forward Primer: S20550_F CCCAATTCTACCTCCCAAAG
Reverse Primer: S20550_R TTTCATCTGGGATACCAAAGC
Reviews

Customers who bought this product also purchased
BY33010
BY33010
FGC30121
FGC30121
Y38089
Y38089
A12510
A12510
Z30038
Z30038
M343
M343
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies