Top » Catalog » SNPs » A5846

$19.00

A5846
[A5846]

A5846
hg38 Position: ChrY:14927647..14927647
Ancestral: G
Derived: A
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b1a2a1a2c (not listed)
Comments: Downstream L21* (DF13-. DF63-)
Forward Primer: A5846_F AGGCTGGTCTTGAATGCCTAG
Reverse Primer: A5846_R GTGCTGTTGCAAGCTGTTAAG
Reviews

Customers who bought this product also purchased
FGC10059
FGC10059
FGC13748
FGC13748
DF41
DF41
BY20463
BY20463
Z16500
Z16500
Y14240
Y14240
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies