Top » Catalog » SNPs » YFS446307

$19.00

YFS446307
[YFS446307]

YFS446307
hg38 Position: ChrY:13166058..13166058
Ancestral: G
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: N1c1a1a1a1a2a4b (not listed)
Comments: Below Y10756 > PH547 > Z35246
Forward Primer: YFS446307_F CTTCCCCAAGCAAATAGGTG
Reverse Primer: YFS446307_R CCAATCTGAATCTCAGCCATTAC
Reviews

Customers who bought this product also purchased
N1c-Z35246 Panel
N1c-Z35246 Panel
YFS446318
YFS446318
YFS446332
YFS446332
YFS446312
YFS446312
YFS446330
YFS446330
YFS446310
YFS446310
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies