Top » Catalog » SNPs » FGC9961

$19.00

FGC9961
[FGC9961]

FGC9961
hg38 Position: ChrY:20960738..20960738
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942
Forward Primer: FGC9961_F TCTTGCCAGAGGAAAGAAGG
Reverse Primer: FGC9961_R AAAAGAACCTTGGTTTCCAAAAC
Reviews

Customers who bought this product also purchased
FGC9927
FGC9927
FGC34120
FGC34120
Z2227
Z2227
Z7700
Z7700
FGC34117
FGC34117
Z6064
Z6064
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies