Top » Catalog » SNPs » A14359

$19.00

A14359
[A14359]

A14359
hg38 Position: ChrY:21475037..21475037
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a
Comments: Below L161.1 > A813 > A13664
Forward Primer: A14359_F ACTAAACACCACCCCACCAG
Reverse Primer: A14359_R TGCACACTTTTGGTGAGAATG
Reviews

Customers who bought this product also purchased
Y16473
Y16473
Y56203
Y56203
Y84307
Y84307
A21222
A21222
Y12073
Y12073
FT14506
FT14506
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies