Top » Catalog » SNPs » V2580

$18.00

V2580
[V2580]

V2580
hg38 Position: ChrY:12650972..12650972
Ancestral: A
Derived: G
Reference: Trombetta et al (2015)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1d1c1
Comments: Aka CTS3243
Forward Primer: V2580_F GTTGGTGGTAGCCAAACAGC
Reverse Primer: V2580_R GTTGTACAACTCCCATGAATACAATATAC
Reviews

Customers who bought this product also purchased
M96
M96
CTS4361
CTS4361
CTS11248
CTS11248
U290
U290
M267
M267
CTS283
CTS283
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies