Top » Catalog » J1 » HU401

$19.00

HU401
[HU401]

HU401
hg38 Position: ChrY:21109210..21109210
Ancestral: A
Derived: C
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS1820
Forward Primer: HU401_F ATGATGGGCAGTTCGTTTG
Reverse Primer: HU401_R TCTTTAGAAGGGCCACGATG
Reviews

Customers who bought this product also purchased
WGS
WGS
A22924
A22924
Y154841
Y154841
A22925
A22925
J1a-ZS1820 Zhibian Panel
J1a-ZS1820 Zhibian Panel
A19265
A19265
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies