Top » Catalog » SNPs » Y154841

$19.00

Y154841
[Y154841]

Y154841
hg38 Position: ChrY:7993168..7993168
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y154841_F TAAGTGTCCATGAAATCTTCATAATTTC
Reverse Primer: Y154841_R ATTTCTGTATAACCCCGTATTCCC
Reviews

Customers who bought this product also purchased
A22919
A22919
A22918
A22918
Y154840
Y154840
A22923
A22923
J1-ZS1820 Fazara II Panel
J1-ZS1820 Fazara II Panel
A22922
A22922
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies