Top » Catalog » R1b » A363

$19.00

A363
[A363]

A363
hg38 Position: ChrY:2894703..2894703
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. FGC4087
Forward Primer: A363_F CCTACTGCCTTCTGGTTTGC
Reverse Primer: A363_R ACCCAAAGAGACCCACTCAG
Reviews

Customers who bought this product also purchased
DF49
DF49
S588
S588
S659
S659
S568
S568
A725
A725
M222
M222
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies