Top » Catalog » R1b » A674

$19.00

A674
[A674]

A674
hg38 Position: ChrY:11953008..11953008
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A674_F CTACATGGGGGACTGAGGTG
Reverse Primer: A674_R GTCGCAATCCTCTTCCTGAC
Reviews

Customers who bought this product also purchased
A671
A671
A679
A679
Wish a SNP
Wish a SNP
A677
A677
A676
A676
A675
A675
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies