Top » Catalog » R1b » A441

$19.00

A441
[A441]

A441
hg38 Position: ChrY:12809592..12809592
Ancestral: C
Derived: T
Reference: Paul Mize (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Approx. DF27
Forward Primer: A441_F ATTTCTGAGCCCAACCTGTG
Reverse Primer: A441_R ACAACCTCTCTCGGAAATGC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Y15850
Y15850
A787
A787
A10951
A10951
A455
A455
A433
A433
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies