Top » Catalog » SNPs » FGC32885

$18.00

FGC32885
[FGC32885]

FGC32885
hg38 Position: ChrY:21462422..21462422
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC32885_F CATATGTCTAAATAATAAGTGAATTGCTCG
Reverse Primer: FGC32885_R CTGACTCCTGTAAATTCAAATGTAGC
Reviews

Customers who bought this product also purchased
FGC23333
FGC23333
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23338
FGC23338
FGC19446
FGC19446
FGC31787
FGC31787
FGC23332
FGC23332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies