Top » Catalog » SNPs » FGC22963

$19.00

FGC22963
[FGC22963]

FGC22963
hg38 Position: ChrY:16955107..16955107
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1c1c
Comments: .
Forward Primer: FGC22963_F GGTTCCTCTCCTCCTAATCAGG
Reverse Primer: FGC22963_R ATTGCCAGGCTTTGGGAC
Reviews

Customers who bought this product also purchased
Z56
Z56
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
BY33663
BY33663
M343
M343
L21
L21
FTA28895
FTA28895
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies