Top » Catalog » SNPs » A6270

$19.00

A6270
[A6270]

A6270
hg38 Position: ChrY:16716874..16716874
Ancestral: A
Derived: C
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6270_F ATGAAATGGTTAAGTATCAGGAGACAG
Reverse Primer: A6270_R ACTGCTGTCTTACTATTGGTGAGG
Reviews

Customers who bought this product also purchased
A6277
A6277
A6272
A6272
A6276
A6276
A6269
A6269
A6275
A6275
A6268
A6268
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies