Top » Catalog » SNPs » A6276

$19.00

A6276
[A6276]

A6276
hg38 Position: ChrY:8450751..8450751
Ancestral: G
Derived: A
Reference: William Davison (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A6276_F CCCACTTGCTTGCCACC
Reverse Primer: A6276_R GAGAGTCATGTCATTTGCATGC
Reviews

Customers who bought this product also purchased
A6273
A6273
A6268
A6268
A6274
A6274
R1b Curley YCAII 22-23 Panel
R1b Curley YCAII 22-23 Panel
A6271
A6271
A6272
A6272
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies