Top » Catalog » SNPs » DF110

$18.00

DF110
[DF110]

DF110
hg38 Position: ChrY:13603862..13603862
Ancestral: G
Derived: A
Reference: Andy Grierson (2014)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Almost all of U152+L2* in northern Wales
Forward Primer: DF110_F GATGCACAGCCAACCAACTT
Reverse Primer: DF110_R ACACTAGTGACTTGCTGGGG
Reviews

Customers who bought this product also purchased
BY38635
BY38635
BY25318
BY25318
FT410015
FT410015
BY25320
BY25320
BY169025
BY169025
BY171286
BY171286
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies