Top » Catalog » SNPs » Z8424

$18.00

Z8424
[Z8424]

Z8424
hg38 Position: ChrY:7048640..7048640
Ancestral: T
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: J2b
Comments: Below Z1043. Approximate with Z8425
Forward Primer: Z8424_F TTTGCAGTCCTGTGTATCTAAACG
Reverse Primer: Z8424_R AATTCTCTTCAAAATGTAAATAAATATATGGTC
Reviews

Customers who bought this product also purchased
J2b-M12 Panel
J2b-M12 Panel
Y26712
Y26712
BY68757
BY68757
Z1295
Z1295
Y146109
Y146109
Z1043
Z1043
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies